Goal

In this lab you will work through some examples to gain a better understanding of concepts related to Graphs and Networks, Network Visualization and the Minimal Spanning Tree; you will also learn the basics of the analysis of microbiome data with a special emphasis on dimension reduction.

Work through this lab by running all the R code to your computer and making sure that you understand the input and the output. We encourage you to work through this lab with a partner. Once you get to the end of this lab, go to Canvas to submit your answers to quiz questions.

You may NOT work with other students to answer the questions on Canvas. You will need a Stanford ID to log in to Canvas.

Setup

Install packages.

pkgs_needed = c("tidyverse","genefilter","ggrepel",
                  "igraph","statnet", "ggnetwork", "rworldmap", "intergraph",
                  "PMA", "phyloseq","vegan", "ade4", "impute")
BiocManager::install(setdiff(pkgs_needed, installed.packages()))

knitr::opts_chunk$set(echo = TRUE, fig.width = 8, fig.height = 6, cache=TRUE)

Graphs and Networks

Load packages.

library("tidyverse")
library("igraph")
library("statnet")
library("ggnetwork")
library("rworldmap")

A Graph \(G = (V, E)\) is a set of \(n\) vertices in \(V\) and a set of edges \(E\) which is a set of unordered pairs of vertices. We say \(i \sim j\) if vertex \(i\) is adjacent to vertex \(j\) and \(i \not\sim j\) otherwise.

An Adjacency Matrix \(\bf A\) is the matrix representation of \(E\). If \(i \sim j\) then the \((i,j)\) entry of \({\bf A}\) is 1. If \(i \not\sim j\) then the \((i,j)\) entry of \({\bf A}\) is 0. So \({\bf A} \in \{0,1\}^{n \times n}\).

A Network is a weighted, directed graph. Networks have adjacency matrices \({\bf A} \in R_+^{n \times n}\).

Graph visualization basics

Graphs and networks have a structure which makes them natural but sometimes difficult to represent as an image. While numbers can be represented on a number line (and plotted against each other), we cannot do this with graphs and networks.

There are two common ways to represent graphs.

  1. Draw (or plot) a graph by plotting vertices as points in two dimensions. Connect two vertices with a line segment if there is an edge between the vertices. This is how graphs are usually visualized. This is useful when edges represent similarity between vertices because points that are similar will appear closer to each other in the figure.

  2. Make a heatmap image of the adjacency matrix. This is useful for larger networks when the vertices can be organized (clustered) into several groups. This is useful when the edges represent interactions between the vertices because it is easy to see how groups of vertices relate to other groups. This visualization is only as good as the way you order the vertices into clusters.

We will first go over a simple example and then make some remarks about these figures.

Very Small Examples

First recall that any finite state space Markov chain can be represented as a network. See Markov chain for some connections between Markov chains and networks.

Now suppose we have a 5 state Markov chain with states \(a, b, c, d, e\). From state \(a\), we can get to states \(b, e\). From state \(b\), we can get to states \(a, d\). From state \(c\), we can get to state \(e\). From state \(d\), we can get to states \(c, e\). From state \(e\), we can get to state \(a\). Suppose we transition from the current state to the next with equal probability over all possible edges (i.e., from \(a\), we can get to states \(b, e\) each with probability \(1/2\)).

First we’ll construct the matrix of potential connections between the states and call that \(A\). Then we’ll divide by the sum in each row to get a transition matrix \(P\).

v1 = letters[1:5] # vertex names: a, b, c, d, e
#            a b c d e
A1 = rbind(c(0,1,0,0,1),
            c(1,0,0,1,0),
            c(0,0,0,0,1),
            c(0,0,1,0,1),
            c(1,0,0,0,0))
dimnames(A1) = list(v1,v1) # assign the names to A
A1
##   a b c d e
## a 0 1 0 0 1
## b 1 0 0 1 0
## c 0 0 0 0 1
## d 0 0 1 0 1
## e 1 0 0 0 0
P1 = diag(1/apply(A1, MARGIN = 1, FUN = sum)) %*% A1
P1
##        a   b   c   d   e
## [1,] 0.0 0.5 0.0 0.0 0.5
## [2,] 0.5 0.0 0.0 0.5 0.0
## [3,] 0.0 0.0 0.0 0.0 1.0
## [4,] 0.0 0.0 0.5 0.0 0.5
## [5,] 1.0 0.0 0.0 0.0 0.0

First we will construct an object representing the above graph starting from the adjacency matrix. We will use the network function:

A1net = network(A1, directed = TRUE) 
A1net
##  Network attributes:
##   vertices = 5 
##   directed = TRUE 
##   hyper = FALSE 
##   loops = FALSE 
##   multiple = FALSE 
##   bipartite = FALSE 
##   total edges= 8 
##     missing edges= 0 
##     non-missing edges= 8 
## 
##  Vertex attribute names: 
##     vertex.names 
## 
## No edge attributes

Below we will plot the network object using a plot() function from the statnet library. Note that plotting network objects use a random number generator so we will use the seed.

set.seed(1)
plot(A1net, label = v1) 

Quiz question 1: Which randomization part does set.seed() concern here?

Answer: position of vertices

When plotting graphs, the goal is to arrange vertices into a two dimensional space so that adjacent vertices are near each other, and non-adjacent vertices are not near each other. This is usually done with Force-directed graph drawing algorithms. You can think of balls in place of the vertices and connecting two balls with a short spring if there is an edge between them and a very long spring if there is not an edge between them. If you jiggle this mess of balls and springs around, you might get a configuration where all the springs are being stretched or compressed with approximately equal force. Note that as mentioned above, this is randomized algorithm.

Instead of using the statnet package we can use ggplot via the ggnetwork package (also the `ggraph package). First, the ggnetwork function converts the graph into a convenient data frame format, as seen below:

A1df = ggnetwork(A1net)
head(A1df)
##           x         y  na.x vertex.names      xend      yend  na.y
## 1 1.0000000 0.4565511 FALSE            a 1.0000000 0.4565511    NA
## 2 0.5977432 0.0000000 FALSE            b 0.5977432 0.0000000    NA
## 3 0.0000000 1.0000000 FALSE            c 0.0000000 1.0000000    NA
## 4 0.1114872 0.4286429 FALSE            d 0.1114872 0.4286429    NA
## 5 0.5693781 0.9170071 FALSE            e 0.5693781 0.9170071    NA
## 6 0.0000000 1.0000000 FALSE            c 0.5446395 0.9206131 FALSE

Afterwards we can use this data frame and ggplot to visualize the graph.

ggf = ggplot(A1df,aes(x = x, y = y, xend = xend, yend = yend)) +
              geom_edges() + 
              geom_nodes(aes(x = x, y = y),size = 6,color = "#8856a7") +
              geom_nodetext(aes(label = vertex.names),size = 4,color = "white") +
              theme_blank() + 
              theme(legend.position = "none")
ggf

Visualizing the Adjacency Matrix

Instead of plotting the graph, we can also visualize the adjacency matrix, e.g., as follows:

heatmap(A1, col = grey(c(0.9,0.1)), symm = TRUE)

A STRING database example

To visualize a more interesting network, we have extracted data on the protein-protein interaction network of Cyclin B1 (coded by the CCNB1 gene) from the STRING database.

ccnb1 = read.table(
  url("http://web.stanford.edu/class/bios221/data/ccnb1datsmall.txt"), 
  header = TRUE, comment.char = "")
head(ccnb1)
##   X.node1  node2 node1_string_id node2_string_id node1_external_id
## 1    HMMR  NDC80          993371          978749   ENSP00000377492
## 2    ASPM DLGAP5          989461          977576   ENSP00000356379
## 3   BUB1B DLGAP5          981056          977576   ENSP00000287598
## 4  MAD2L1   RFC4          981786          981740   ENSP00000296509
## 5    HMMR  CDC20          993371          983275   ENSP00000377492
## 6   BIRC5  NCAPH          982434          977260   ENSP00000301633
##   node2_external_id neighborhood fusion cooccurence homology coexpression
## 1   ENSP00000261597            0      0           0    0.543        0.914
## 2   ENSP00000247191            0      0           0    0.000        0.911
## 3   ENSP00000247191            0      0           0    0.000        0.900
## 4   ENSP00000296273            0      0           0    0.000        0.915
## 5   ENSP00000308450            0      0           0    0.000        0.901
## 6   ENSP00000240423            0      0           0    0.000        0.911
##   experimental knowledge textmining combined_score
## 1            0         0          0          0.914
## 2            0         0          0          0.911
## 3            0         0          0          0.900
## 4            0         0          0          0.916
## 5            0         0          0          0.901
## 6            0         0          0          0.911
ccnb1_v = levels(unlist(ccnb1[,1:2]))                   # vertex names
ccnb1_n = length(ccnb1_v)                               # number of vertices
ccnb1_e = matrix(
  match(as.character(unlist(ccnb1[,1:2])), ccnb1_v),    # edge list (as pair of indices)
  ncol = 2, byrow = FALSE) 
ccnb1_w = ccnb1$coexpression                            # edge weights

Below we will call M our co-expression network adjacency matrix. Since the STRING data only says if proteins i and j are co-expressed and doesn’t distinguish between i,j and j,i we want to make M symmetric (undirected) by considering the weight on i,j is the same as from j,i.

M = matrix(0, ccnb1_n, ccnb1_n)                  # set up a co-expression matrix
M[ccnb1_e] = ccnb1_w                             # fill it in with edge weights
M = M + t(M)                                     # make this symmetric
dimnames(M) = list(ccnb1_v, ccnb1_v)             # label the vertices

# A is our co-expression graph adjacency matrix:
# We let A_ij = 1 if i and j are coexpressed
A = 1*(M > 0)

Let’s create the network:

ccnb1_net = network(A, directed = FALSE)
ccnb1_net
##  Network attributes:
##   vertices = 43 
##   directed = FALSE 
##   hyper = FALSE 
##   loops = FALSE 
##   multiple = FALSE 
##   bipartite = FALSE 
##   total edges= 207 
##     missing edges= 0 
##     non-missing edges= 207 
## 
##  Vertex attribute names: 
##     vertex.names 
## 
## No edge attributes

Note that again we constructed the network from the adjacency matrix, however we could just as well have used the edge list, e.g.:

network(ccnb1_e, directed = FALSE)
##  Network attributes:
##   vertices = 43 
##   directed = FALSE 
##   hyper = FALSE 
##   loops = FALSE 
##   multiple = FALSE 
##   bipartite = FALSE 
##   total edges= 207 
##     missing edges= 0 
##     non-missing edges= 207 
## 
##  Vertex attribute names: 
##     vertex.names 
## 
## No edge attributes

Now let’s plot the graph:

set.seed(1)                               # make the plot look the same as mine
par(mar = rep(0,4))                       # make plot margins 0
plot(ccnb1_net, label = ccnb1_v)          # plot the network and label the vertices

Change the seed above to another number and observe what happens.

Let’s also make a heatmap:

# make a heatmap image with colors: white below 0.9,
# grey from 0.9 to 1 with darker closer to 1
breaks = c(0, seq(0.9, 1, length = 11))               # breaks in the color bins
cols = grey(1 - c(0, seq(0.5, 1, length = 10)))       # colors

# color the vertex for CCNB1 blue, its neighbors red, and the others white
ccnb1ind = which(ccnb1_v == "CCNB1")                  # index for ccnb1
vcols = rep("white", ccnb1_n)
vcols[ccnb1ind] = "blue"
vcols[which(M[, ccnb1ind] > 0 | M[ccnb1ind, ] > 0 )] = "red"  

# now actually make the heat map
par(mar = rep(0,4))                                    # make plot margins 0
heatmap(M, symm = TRUE, ColSideColors = vcols, RowSideColors = vcols,
        col = cols, breaks = breaks,  frame = T)
legend("topleft", c("Neighbors(CCNB1)", "CCNB1"), fill = c("red","blue"),  
       bty = "n", inset = 0, xpd = T,  border = F)

This gives a visualization of the strongest interactions in the two step neighborhood of CCNB1. Both the plotted graph and the heatmap image show the same data: there seems to be a cluster of proteins which are all similar to CCNB1 and there is a cluster of other proteins. Many of the proteins in the CCNB1 cluster are coexpressed at the same time as each other.

Minimum Spanning Trees

A very simple and useful graph is the so-called minimum spanning tree (MST). Given distances between vertices; the MST is the tree that spans all the points and has the minimum total length.

There are many implementations for computing the MST in R, e.g. the function mst in the igraph package, as well as the ape package.

Here we are going to take the DNA sequence distances between strains of HIV from patients all over the world and construct their minimum spanning tree.

load(url("http://web.stanford.edu/class/bios221/data/dist2009.RData"))
# clean up names a bit
country09 = sapply(attr(dist2009, "Labels"), function(x) {
  strsplit(x,"_") %>% unlist %>% `[`(length(.))
  })  %>%
  unname %>%
  ifelse(. ==  "U.S.", "United States", .)
attr(dist2009, "Labels") = country09

Now let’s find the MST (in adjacency matrix form) and use the igraph package to convert it into a graph object. Finally we plot it using ggnetwork:

# this takes a few minutes
mstree2009 = ape::mst(dist2009)
gr09 = graph.adjacency(mstree2009, mode = "undirected")
gg = ggnetwork(gr09, arrow.gap = 0, layout = "fruchtermanreingold")

ggplot(gg, aes(x = x, y = y, xend = xend, yend = yend)) +
  geom_edges(color = "black",alpha = 0.5,curvature = 0.1) +
  geom_nodes(aes(color = vertex.names), size = 2) +
  geom_nodetext(aes(label = vertex.names), color = "black",size = 2) +
  theme_blank() +
  guides(color = guide_legend(keyheight = 0.1,keywidth = 0.1,
      title = "Countries"))

Quiz question 2: How many edges are in this MST?

Answer:

sum(mstree2009)/2
## [1] 511

It could be preferable to use a graph layout that incorporates the known geographic coordinates. Thus, we might be able to see how the virus jumped large distances across the world through traveler mobility. We introduce approximate country coordinates which we then jitter slightly to avoid too much overlapping. Here, we use we use countriesLow object from rworldmap package to find the latitudes and longitudes of countries.

mat = match(country09, countriesLow$NAME)
lat2009 = countriesLow$LAT[mat]
lon2009 = countriesLow$LON[mat]
coords2009 = data.frame(lat = lat2009, lon = lon2009, country = country09)
x = jitter(coords2009$lon, amount = 15)
y = jitter(coords2009$lat, amount = 8)
layoutCoordinates = cbind(x, y)
labc = names(table(country09)[which(table(country09) > 1)])
idx = match(labc, countriesLow$NAME)
latc = countriesLow$LAT[idx]
lonc = countriesLow$LON[idx]
dfc = data.frame(latc, lonc, labc)
dfctrans = dfc
dfctrans[, 1] = (dfc[, 1]+31)/(93)
dfctrans[, 2] = (dfc[, 2]+105)/(238)

ggeo09 = ggnetwork(gr09, arrow.gap = 0, layout= layoutCoordinates)
ggplot(ggeo09,  aes(x = x,  y = y, xend = xend,  yend = yend)) +
  geom_edges(color  = "black", alpha = 0.5, curvature = 0.1) +
  geom_nodes(aes(color = vertex.names), size = 2) +
  theme_blank() +
  geom_label(
    data = dfctrans,aes(x = lonc, xend = lonc,
                        y = latc, yend = latc, label = labc,
  fill = labc),colour = "white", alpha = 0.5, size = 3)+
   theme(legend.position = "none")
## Warning: Ignoring unknown aesthetics: xend, yend

Microbiome analysis

In this section we will go through examples of Multivariate Analysis methods for heterogeneous data, which were discussed in class.

Load packages

library("ggplot2")
library("PMA")
library("dplyr")
library("ade4")
library("genefilter")
library("ggrepel")
library("phyloseq")
library("vegan")

Data import

The data we will analyze in the first part of the lab corresponds to 360 fecal samples which were collected from 12 mice longitudinally over the first year of life, to investigate the development and stabilization of the murine microbiome. Let’s download the dataset:

download.file("https://cdn.rawgit.com/spholmes/F1000_workflow/891463f6/data/ps.rds",
              "ps.rds", mode = "wb")
ps = readRDS("ps.rds")

The ps object is of class phyloseq from the package phyloseq.

class(ps)
## [1] "phyloseq"
## attr(,"package")
## [1] "phyloseq"

As has been mentioned before, the phyloseq package is a tool to import, store, analyze, and graphically display complex phylogenetic sequencing data. Take some time to explore the object, before we start doing statistical analyses:

Quiz question 3: How many slots does the ps object have?

Answer:

length(slotNames(ps))
## [1] 5

Quiz question 4: How many distinct Phyla (such as “Bacteroidetes”) have been identified in this dataset? (Hint: Look up the tax_table function and then inspect its output. Also make sure to ignore potential NA values!)

Answer:

length(unique(na.omit( tax_table(ps)[,"Phylum"])))
## [1] 10

Quiz question 5: In total, does this dataset include more measurements for female or male mice (Hint: Look up the documentation of sample_data)?

Answer: Male

Quiz question 6: How many unique female mice were part of this experiment?

Answer:

sample_data(ps) %>%
           group_by(host_subject_id) %>%
           summarize(sex=sex[1]) %>% 
           pull(sex) %>% 
           table
## .
## F M 
## 6 6

Preprocessing

Before doing the multivariate projections, we will do some basic preprocessing. First we remove features with ambiguous Phylum annotation:

ps = subset_taxa(ps, !is.na(Phylum) & !Phylum %in% c("", "uncharacterized"))

Now let’s look at a histogram of the ages of the mice:

ggplot(sample_data(ps), aes(x = age)) + 
               geom_histogram(bins=40) + 
               xlab("age")

We see that the ages of the mice come in a couple of groups, and so we make a categorical variable corresponding to young, middle-aged, and old mice.

sample_data(ps)$age_binned = cut(
  sample_data(ps)$age, breaks = c(0, 100, 200, 400))

Next, we apply an inverse hyperbolic sine transform on the data.

This is an approximate variance stabilizing transformation (it would be more appropriate to use the variance stabilizing functionality available in the DESeq2 package).

pstrans = transform_sample_counts(ps, function(x) asinh(x))

We can plot the phylogenetic tree associated withe the data:

plot_tree(pstrans, "treeonly")

A first principal coordinates analysis (PCoA)

For a first pass, we look at principal coordinates analysis (PCoA) with either the Bray-Curtis dissimilarity on the weighted Unifrac distance.

set.seed(10)     # for random assignment of the root in the phylogenetic tree
# The function call below might take some time due to weighted UniFrac distance computations
out_wuf_asinh = ordinate(pstrans, method= "MDS", distance = "wunifrac")
## Warning in UniFrac(physeq, weighted = TRUE, ...): Randomly assigning root as --
## GCAAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTCTGGAAACTGCGCCGCTGGAGTACGGGAGGGGCAGGCGGAATTCCTGGTGTAGCGGTGAAATGCGTAGATATCAGGAGGAACACCGGCGGCGAAGGCGGCCTGCTGGACCGTGACTGACGTTGAGGCTCGAGAGCGTGGGGAG
## -- in the phylogenetic tree in the data you provided.
evals = out_wuf_asinh$values$Eigenvalues
plot_ordination(pstrans, out_wuf_asinh, color = "age_binned", shape = "sex") +
  labs(col = "Binned Age") +
  coord_fixed(sqrt(evals[2] / evals[1]))

Quiz question 7: The above plot shows the proportion of variance explained by the 1st axis around 46% and the 2nd axis around 11%. What is the variance explained by the 3rd axis? (Hint: Look at evals. Note that evals[1], evals[2] is 2.25, 0.55)

Answer:

evals[3]/sum(evals)*100
## [1] 7.552004

We see immediately that there are some outliers. We will take them out, since we are mainly interested in the relationships between the non-outlier points (however, here we skip the details of how to specify the outliers).

outlier_idx = rownames(sample_data(pstrans)) %in% c("M3D149","M2D19","M1D9", "M1D149", "F5D165", "F6D165")
pstrans2 = prune_samples(!outlier_idx, pstrans)

Quiz Question 8: Redo the same ordination as above after outlier removal. What is the proportion of variance explained by the 1st axis?

Answer:

set.seed(10)     # for random assignment of the root in the phylogenetic tree
# The function call below might take some time due to weighted UniFrac distance computations
out_wuf_asinh2 = ordinate(pstrans2, method= "MDS", distance = "wunifrac")
## Warning in UniFrac(physeq, weighted = TRUE, ...): Randomly assigning root as --
## GCAAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGGAGTGAAAGCCCGGGGCCCAACCCCGGGACTGCTCTGGAAACTGCGCCGCTGGAGTACGGGAGGGGCAGGCGGAATTCCTGGTGTAGCGGTGAAATGCGTAGATATCAGGAGGAACACCGGCGGCGAAGGCGGCCTGCTGGACCGTGACTGACGTTGAGGCTCGAGAGCGTGGGGAG
## -- in the phylogenetic tree in the data you provided.
evals2 = out_wuf_asinh$values$Eigenvalues
evals2[1]/sum(evals2)*100
## [1] 46.13946

Different ordination projections

In this section we will explore different ordination projections.

First we will perform a PCoA using Bray-Curtis dissimilarity.

out_bc_asinh = ordinate(pstrans2, method = "MDS", distance = "bray")
evals_bc = out_bc_asinh$values$Eigenvalues
plot_ordination(pstrans2, out_bc_asinh, color = "age_binned") +
  coord_fixed(sqrt(evals_bc[2] / evals_bc[1])) +
  labs(col = "Binned Age")

The plot above shows the ordination of the samples, and we see that the second axis corresponds to an age effect, with the samples from the younger and older mice separating fairly well.

Next we look at double principal coordinates analysis (DPCoA), which is a phylogenetic ordination method that provides a biplot representation of both samples and taxonomic categories. (Warning: This next line will take a while to compute.)

# this might take a while
out_dpcoa_asinh = ordinate(pstrans2, method = "DPCoA")
evals_dpcoa = out_dpcoa_asinh$eig
plot_ordination(pstrans2, out_dpcoa_asinh, color = "age_binned",
                shape = "family_relationship") +
  coord_fixed(sqrt(evals_dpcoa[2] / evals_dpcoa[1])) +
  labs(col = "Binned Age", shape = "Litter")

We see again that the second axis corresponds to young vs. old mice.

plot_ordination(pstrans2, out_dpcoa_asinh, type = "species", color = "Phylum") +
  coord_fixed(sqrt(evals_dpcoa[2] / evals_dpcoa[1]))

The second plot suggests an interpretation of the second axis: samples that have larger scores on the second axis have more taxa from Bacteroidetes and one subset of Firmicutes.

Quiz question 9: Consider a sample which is particularly enriched in bacteria from the Bacteroidetes Phylum. Do you think it is more likely that its projection on the first axis will have a positive value or negative value?

Answer: Positive